Material and Method: Bone marrow aspiration materials of seven healthy donors aged between 3 and 32 (2 males/5 females) were investigated with qPCR analysis after RNA isolation for the presence of DUX4 full length mRNA expression. Samples have been investigated for protein existence of DUX4 via immunohistochemistry in two donors that had sufficient aspiration material.
Results: DUX4 mRNA expression was present in all donors, with higher expression compared to B-actin. DUX4 positive stained cells were also detected by immunohistochemistry.
Conclusion: With these results, novel expression for DUX4 in hematopoietic tissue is described. Further studies on the function of DUX4 in hematopoietic cells can shed light on DUX4-related pathways, and contribute to the treatment of DUX4-related diseases such as B-ALL, other cancers, and facioscapulohumeral muscular dystrophy.
Donors
Two males, five females, a total of seven healthy bone
marrow donors have been included in this study. Their ages
varied between 3 and 32. Age and gender information of
the donors have been summarised in Table I.
Table I: Gender and age of healthy donors.
Bone Marrow Sampling
After the application of topical anaesthesia, bone marrow
material has been obtained with superior iliac crest
aspiration.
RNA extraction
Total RNA isolation from bone marrow samples has been
performed with the Qiamp RNA blood mini kit (Qiagen).
cDNA synthesis
Obtained total RNA was converted into cDNA using a
Blue-Ray PCR device in accordance with the protocol
with Applied Biosystems High-Capacity cDNA Reverse
Transcription Kit (4368814). The converted cDNA samples
were stored at -20°C. Reverse transcriptase PCR conditions
were: 25ºC 10 minutes, 37oC 120 minutes, 85ºC 5 minutes,
4ºC ∞.
Spectrophotometric Measurement of cDNA Samples
Amount and purity measurements of the isolated cDNA
samples were determined with a spectrophotometer
(Quawell / Q9000B). For the measurement, 2 μl of cDNA
sample was loaded into the spectrophotometer device. The
purity and amount of cDNA were determined in ng/μl with
the ratio of measurements obtained at 260 nm and 280 nm
wavelengths of the samples. cDNA samples were diluted to
100 ng/μl for use in PCR studies.
Quantitative Real-Time Polymerase Chain Reaction
(qRT-PCR)
Applied BiosystemsTM StepOnePlusTM Real-Time PCR
device and PowerUpTM SYBRTM Green Master Mix
(A25776) kit were used in accordance with the protocol
to determine the level of DUX4 gene expression. Mixes
containing the cDNAs of each donor were added to the
96-well plate in at least three replicates. For the analysed
DUX4 gene, a negative control plate containing no cDNA
was loaded. The B-actin gene, which is the housekeeping
gene, was used as control gene in the analyses. The primer
pair for B-actin is 5-CCTGGCACCCAGCACAAT-
3(forward) and 5-GCCGATCCACACGGAGTACT-3
(reverse). The primer sequences used for the DUX4-fl are
CAAGGGGTGCTTGCGCCACCCACGT (forward) and
GGGGTGCGCACTGCGCGCAGGT (reverse). qPCR
conditions were: 95oC 10 minutes, 95ºC 15 seconds, 60ºC
1 minute, 40 cycles.
qPCR analysis had been performed at least three times for each sample. The average of the results was calculated and integrated into the graphic by converting into the nearest integer
Agarose Gel Electrophoresis
To control the presence of DUX4 cDNA conversion and
amplicon size of DUX4-fl transcript, RT-PCR products
were run on 2% agarose gel.
Immunohistochemistry
Bone marrow aspiration materials from two donors were
immunohistochemically stained for DUX4 using rabbit
monoclonal IgG E5-5 antibody (cloneP4H2) raised against
a synthetic peptide corresponding to the C-terminus of the
human DUX4 protein (catalog no ab124699; Abcam). E5-5
antibody recognizes the C terminal domain of DUX4 [19].
An automated DAKO Omnis staining platform was used
to perform all immunohistochemical procedures, with the
aid of the Optiview detection kit. Antibody staining was
performed at 1:50 dilution.
DUX4 Protein Staining was Positive in the Cells that
were Relatively Larger
Donor 2 and donor 3, who had sufficient aspiration material,
were also investigated with DUX4 protein staining. Both
donor 2 and 3 had a portion of positively staining cells
in their bone marrow aspirates. Staining density was low.
Positively stained hematopoietic cells were observed to be larger in size relative to negatively stained cells in bone
marrow aspirates (Figure 2A,B and 3A).
Positive staining of two huge cells revealed a positive expression of DUX4 protein in megakaryocytes (Figure 3B).
DUX4 is a pioneer transcription factor and has essential roles in zygotic gene activation [1-3]. Pioneer transcription factors initiate cell differentiation, and they activate cell specific genes. Pioneer TFs need to be expressed at certain time points and in precise amounts: they have spatiotemporal speciality. For example, PAX7 is another homeobox TF [29] that has exchangeable domains with DUX4 [30]. Mayran et al. have revealed that even transient PAX7 expression is sufficient for the cell fate [29]. Similar to that, the quantity of expression level [31] and spatiotemporal specificity [32] are critical for DUX4 expression. Expression of transient bursts of stochastic expression in a small proportion of FSHD myonuclei [6] especially supports the spatiotemporal pattern of DUX4.
DUX4 binds to its target genes via its N terminal domain [4] and activates transcription via its C terminal domain by attracting histone acetyl transferase (HAT) complexes to that area [33]. DUX4s does not contain a C terminal while DUX4-fl contains a C terminal domain and can activate gene expression. In addition, DUX4s is normally expressed in somatic tissues, while DUX4-fl is assumed not to be expressed in healthy somatic tissues [6]. Because of these, we preferred to investigate DUX-fl in somatic hematopoietic cells, and used DUX4-fl specific primers for mRNA analysis and antibody that recognises C-terminal domain for the protein analysis. Two males and five females aged between 3 to 32 were analysed for DUX4 expression. As a result, in mRNA level, we detected that DUX4-fl were present and expression levels were close to each other in all of the samples without any exception. Remarkably, expression of DUX4-fl mRNA levels was higher compared to B-actin levels (Figure 1A,B). No significant difference was present in the expression of DUX4 depending on age and gender factors; except a relative higher level in Donor 5 who was an adolescent female. This may be related to effect of estradiol on DUX4 that had been revealed in FSHD studies in skeletal tissue [34-36]. It can be interesting to investigate this in detail in future studies. Regardless of non-significant level differences, it might be said that our data revealed present DUX4-fl expression in seven healthy somatic bone marrow cells without exception, independent of age and gender factors. This novel data can indicate that DUX4-fl has evident function(s) in somatic healthy hematopoietic cells.
In order to observe whether DUX4 expression is present at the protein level in the hematopoietic cells, we performed immunohistochemical staining of the semi-liquid aspirates of two donors that had remaining aspiration materials. In these preparations, slight staining has been observed (Figure 2 and 3), indicating a low expression level of DUX4-fl similar to that observed in FSHD cells [6,9,37]. Slight staining is compatible with its pioneer role in other cell types. This slight positive staining was detected in not all but some part of the cells (Figure 2A,B, 3A) and was remarkably larger in size compared to negatively stained ones (Figure 2A and 3A). In hematopoietic tissue, larger cells indicate progenitor cells that are in the earlier stages of differentiation [38]. Because of that, positive staining in the cells with larger nuclei might suggest that DUX4 is an active TF especially in progenitor hematopoietic cells that came into play in earlier stages and that might be in the less differentiated status. Partial positive staining of the cell population might also support the spatiotemporal expression of DUX4. Interestingly, the observed megakaryocytic cells that had staining with a huge nucleus (Figure 3B) may indicate an additional role of DUX4 for thrombocyte function. DUX4 expression in megakaryocytic cells has not been revealed before and might be valuable for understanding thrombocyte-related diseases. Because of this, it is worthwhile and necessary to identify cell type specific expression of DUX4 in future studies.
Since its direct genetic relationship and numerous related studies in literature, FSHD provides most of the information on the function of DUX4. In a developmental model on FSHD it was suggested that DUX4-fl is normally expressed in early development and suppressed during cellular differentiation [6]. However, recent results indicate that DUX4-fl is also expressed in later phases of cellular differentiation. Gannon et al. have revealed that latedifferentiating keratinocytes expressed DUX4 [12]. Jones and Banerji et al. have revealed DUX-fl expression in lymphoblastoid cells [21,22] and Das and Chadwick have revealed DUX4 expression in the cells of thymus [13]. It was revealed that some of the healthy muscle- derived cells also exhibited DUX4 expression [31]. These cells might be in the later phases of differentiation. Supporting that, we observed easier detection of DUX4 protein in first passages (observational data) in our previous study on in vitro estradiol treatment in FSHD cell culture [36]. On the other hand, with the presence of DUX4-fl in pluripotent hematopoietic cells, this present study revealed that expression of DUX4- fl not only specific to late differentiating somatic cells, but it can also be expressed in the earlier phases of cellular differentiation. Supporting this, DUX4 expression in early differentiation was revealed to be present also in hMSCs [23]. Expression in the earlier phases of differentiation might shed light on other DUX4 related diseases such as FSHD. Deficiency or spatiotemporal disturbance of DUX4 at earlier stages of cell differentiation might explain FSHD. Supporting that DUX4-fl expression in differentiated skeletal cells is not sufficient for FSHD to occur [31]. Our results might signify a hypothesis: deficiency or disturbance in the critical spatiotemporal timing and amount-quantity of DUX4 expression could result in pathology in the precursor potent cells at earlier stages and end up with a decreased healthy cell pool. Observation of molecular disease markers in fetal FSHD muscles is compatible with early disturbance of DUX4 [39]. Stabilization or derepression of re-expressed DUX4 via accomplishing qA allele, SMCHD1 or DNMT3B or LRIF1 mutations [40-42] can contribute to spatiotemporal disturbance of DUX4 and lead to the DUX4 toxicity observed in later phases of differentiation. There are multiple treatment trials that aim to inhibit DUX4. Inhibition of DUX4 can prevent these cells from going into apoptosis by eliminating DUX4 toxicity in differentiated FSHD cells. However, it might not provide sufficient clinical improvement in case of a deficiency or disturbance of DUX4 in the early stages. Additionally and importantly, DUX4 inhibition might cause side effects related to the aforementioned cell types that actively need DUX4 expression.
In summary, with the present study it was shown that DUX4 is an active TF in progenitor hematopoietic cells. We suggest that DUX4 expression in earlier stages of cell differentiation can be critical, and DUX4 deficiency and/or spatiotemporal DUX4 disturbance might be related to the pathology of diseases (Figure zffigure4>4A,B).
In conclusion, DUX4-fl, which is assumed to have rare expression in somatic cells, was found to be present in healthy bone marrow aspirates at both the mRNA and protein level in this study. With this data, it was revealed that the DUX4 expression shown in hematologic malignancy, which is said to be re-expressed in B-ALL, is already expressed by some part of healthy bone marrow cells. The obtained data from this study indicate that the expression of DUX4 should be reviewed and studied in all tissues in future studies, especially in progenitor potent cells. Clarifying the role of DUX4 in potent healthy somatic cells might provide key information for the pathophysiology of B-ALL, other DUX4 related cancers, and FSHD. With further information, more comprehensive treatment strategies can be developed in DUX4 related diseases.
STUDY LIMITATIONS
Since it is an invasive approach, bone marrow sampling in a
separate study is not ethical. Therefore, this study had been
carried out using bone marrow samples from healthy bone
marrow donors, remaining after transplantation. Because
of this, a limited amount and number of materials could
be examined.
CONFLICT of INTEREST
All authors declare that they have no conflict of interest.
AUTHORSHIP CONTRIBUTIONS
Concept: CH, SBK, Design: CH, SBK, OT, BA, HY, FTK,
ANA, Data collection or processing: OT, CH, BA, HY,
FTK, ANA, SBK, Analysis or Interpretation: CH, OT,
SBK, Literature search: CH, SBK, OT, BA, HY, FTK, ANA,
Writing: CH, SBK, OT, BA, HY, FTK, ANA, Approval:
CH, SBK, OT, BA, HY, FTK, ANA.
1) Campbell AE, Belleville AE, Resnick R, Shadle SC, Tapscott SJ.
Facioscapulohumeral dystrophy: Activating an early embryonic
transcriptional program in human skeletal muscle. Hum Mol
Genet. 2018;27(R2):R153-R62.
2) De Iaco A, Planet E, Coluccio A, Verp S, Duc J, Trono D. DUXfamily
transcription factors regulate zygotic genome activation in
placental mammals. Nat Genet. 2017;49:941-5.
3) Hendrickson PG, Dorais JA, Grow EJ, Whiddon JL, Lim JW,
Wike CL, Weaver BD, Pflueger C, Emery BR, Wilcox AL, Nix
DA, Peterson CM, Tapscott SJ, Carrell DT, Cairns BR. Conserved
roles of mouse DUX and human DUX4 in activating cleavagestage
genes and MERVL/HERVL retrotransposons. Nat Genet.
2017;49:925-34.
4) Gabriels J, Beckers MC, Ding H, De Vriese A, Plaisance S, van
der Maarel SM, Padberg GW, Frants RR, Hewitt JE, Collen D,
Belayew A. Nucleotide sequence of the partially deleted D4Z4
locus in a patient with FSHD identifies a putative gene within
each 3.3 kb element. Gene. 1999;236:25-32.
5) van Deutekom JC, Wijmenga C, van Tienhoven EA, Gruter AM,
Hewitt JE, Padberg GW, van Ommen GJ, Hofker MH, Frants
RR. FSHD associated DNA rearrangements are due to deletions
of integral copies of a 3.2 kb tandemly repeated unit. Hum Mol
Genet. 1993;2:2037-42.
6) Snider L, Geng LN, Lemmers RJLF, Kyba M, Ware CB, Nelson
AM, Tawil R, Filippova GN, van der Maarel SM, Tapscott
SJ, Miller DG. Facioscapulohumeral dystrophy: Incomplete
suppression of a retrotransposed gene. Plos Genet. 2010;6.
7) Young JM, Whiddon JL, Yao Z, Kasinathan B, Snider L, Geng
LN, Balog J, Tawil R, van der Maarel SM, Tapscott SJ. DUX4
binding to retroelements creates promoters that are active in
FSHD muscle and testis. Plos Genet. 2013;9:e1003947.
8) Wijmenga C, Hewitt JE, Sandkuijl LA, Clark LN, Wright TJ,
Dauwerse HG, Gruter AM, Hofker MH, Moerer P, Williamson
R. Chromosome 4q DNA rearrangements associated with
facioscapulohumeral muscular dystrophy. Nat Genet. 1992;2:26-
30)
9) Lemmers RJ, van der Vliet PJ, Klooster R, Sacconi S, Camano P,
Dauwerse JG, Snider L, Straasheijm KR, van Ommen GJ, Padberg
GW, Miller DG, Tapscott SJ, Tawil R, Frants RR, van der Maarel
SM. A unifying genetic model for facioscapulohumeral muscular
dystrophy. Science. 2010;329:1650-3.
10) Lemmers RJ, de Kievit P, Sandkuijl L, Padberg GW, van Ommen
GJ, Frants RR, van der Maarel SM. Facioscapulohumeral
muscular dystrophy is uniquely associated with one of the two
variants of the 4q subtelomere. Nat Genet. 2002;32:235-6.
11) Kowaljow V, Marcowycz A, Ansseau E, Conde CB, Sauvage S,
Matteotti C, Arias C, Corona ED, Nunez NG, Leo O, Wattiez
R, Figlewicz D, Laoudj-Chenivesse D, Belayew A, Coppee F,
Rosa AL. The DUX4 gene at the FSHD1A locus encodes a proapoptotic
protein. Neuromuscul Disord. 2007;17:611-23.
12) Gannon OM, Merida de Long L, Saunders NA. DUX4 is
derepressed in late-differentiating keratinocytes in conjunction
with loss of H3K9me3 epigenetic repression. J Invest Dermatol.
2016;136:1299-302.
13) Das S, Chadwick BP. Influence of repressive histone and DNA
methylation upon D4Z4 transcription in non-myogenic cells.
PLoS One. 2016;11:e0160022.
14) Kawamura-Saito M, Yamazaki Y, Kaneko K, Kawaguchi N,
Kanda H, Mukai H, Gotoh T, Motoi T, Fukayama M, Aburatani
H, Takizawa T, Nakamura T. Fusion between CIC and DUX4
up-regulates PEA3 family genes in Ewing-like sarcomas with t (4;
19) (q35 ; q13) translocation. Hum Mol Genet. 2006;15:2125-37.
15) Chew GL, Campbell AE, De Neef E, Sutliff NA, Shadle SC,
Tapscott SJ, Bradley RK. DUX4 suppresses MHC class I to
promote cancer immune evasion and resistance to checkpoint
blockade. Dev Cell. 2019;50:658-671-57.
16) Rehn JA, OConnor MJ, White DL, Yeung DT. DUX huntingclinical
features and diagnostic challenges associated with DUX4-
rearranged leukaemia. Cancers (Basel). 2020;12:2815.
17) Zhang J, McCastlain K, Yoshihara H, Xu B, Chang Y, Churchman
ML, Wu G, Li Y, Wei L, Iacobucci I, Liu Y, Qu C, Wen J,
Edmonson M, Payne-Turner D, Kaufmann KB, Takayanagi SI,
Wienholds E, Waanders E, Ntziachristos P, Bakogianni S, Wang
J, Aifantis I, Roberts KG, Ma J, Song G, Easton J, Mulder HL, Chen
X, Newman S, Ma X, Rusch M, Gupta P, Boggs K, Vadodaria B,
Dalton J, Liu Y, Valentine ML, Ding L, Lu C, Fulton RS, Fulton L,
Tabib Y, Ochoa K, Devidas M, Pei D, Cheng C, Yang J, Evans WE,
Relling MV, Pui CH, Jeha S, Harvey RC, Chen IL, Willman CL,
Marcucci G, Bloomfield CD, Kohlschmidt J, Mrozek K, Paietta E,
Tallman MS, Stock W, Foster MC, Racevskis J, Rowe JM, Luger
S, Kornblau SM, Shurtleff SA, Raimondi SC, Mardis ER, Wilson
RK, Dick JE, Hunger SP, Loh ML, Downing JR, Mullighan CG,
St. Jude Childrens Research Hospital-Washington University
Pediatric Cancer Genome P. Deregulation of DUX4 and ERG in
acute lymphoblastic leukemia. Nat Genet. 2016;48:1481-9.
18) Yasuda T, Tsuzuki S, Kawazu M, Hayakawa F, Kojima S, Ueno T,
Imoto N, Kohsaka S, Kunita A, Doi K, Sakura T, Yujiri T, Kondo
E, Fujimaki K, Ueda Y, Aoyama Y, Ohtake S, Takita J, Sai E,
Taniwaki M, Kurokawa M, Morishita S, Fukayama M, Kiyoi H,
Miyazaki Y, Naoe T, Mano H. Recurrent DUX4 fusions in B cell
acute lymphoblastic leukemia of adolescents and young adults.
Nat Genet. 2016;48:569-74.
19) Geng LN, Tyler AE, Tapscott SJ. Immunodetection of human
double homeobox 4. Hybridoma (Larchmt). 2011, 30:125-30.
20) Whiddon JL, Langford AT, Wong CJ, Zhong JW, Tapscott SJ.
Conservation and innovation in the DUX4-family gene network.
Nat Genet. 2017;49:935-40.
21) Jones TI, Himeda CL, Perez DP, Jones PL. Large family
cohorts of lymphoblastoid cells provide a new cellular model
for investigating facioscapulohumeral muscular dystrophy.
Neuromuscul Disord. 2017;27:221-38.
22) Banerji CRS, Panamarova M, Zammit PS. DUX4 expressing
immortalized FSHD lymphoblastoid cells express genes elevated
in FSHD muscle biopsies, correlating with the early stages of
inflammation. Hum Mol Genet. 2020;29:2285-99.
23) de la Kethulle de Ryhove L, Ansseau E, Nachtegael C, Pieters
K, Vanderplanck C, Geens M, Sermon K, Wilton SD, Coppee
F, Lagneaux L, Belayew A. The role of D4Z4-encoded proteins
in the osteogenic differentiation of mesenchymal stromal cells
isolated from bone marrow. Stem Cells Dev. 2015;24:2674-86.
24) Dellavalle A, Sampaolesi M, Tonlorenzi R, Tagliafico E, Sacchetti
B, Perani L, Innocenzi A, Galvez BG, Messina G, Morosetti R, Li
S, Belicchi M, Peretti G, Chamberlain JS, Wright WE, Torrente
Y, Ferrari S, Bianco P, Cossu G. Pericytes of human skeletal
muscle are myogenic precursors distinct from satellite cells. Nat
Cell Biol. 2007;9:255-67.
25) Marincevic-Zuniga Y, Dahlberg J, Nilsson S, Raine A, Nystedt
S, Lindqvist CM, Berglund EC, Abrahamsson J, Cavelier L,
Forestier E, Heyman M, Lönnerholm G, Nordlund J, Syvänen
AC. Transcriptome sequencing in pediatric acute lymphoblastic
leukemia identifies fusion genes associated with distinct DNA
methylation profiles. J Hematol Oncol. 2017;10:148.
26) Liu YF, Wang BY, Zhang WN, Huang JY, Li BS, Zhang M, Jiang
L, Li JF, Wang MJ, Dai YJ, Zhang ZG, Wang Q, Kong J, Chen B,
Zhu YM, Weng XQ, Shen ZX, Li JM, Wang J, Yan XJ, Li Y, Liang
YM, Liu L, Chen XQ, Zhang WG, Yan JS, Hu JD, Shen SH, Chen
J, Gu LJ, Pei DQ, Li YJ, Wu G, Zhou X, Ren RB, Cheng C, Yang JJ,
Wang KK, Wang SY, Zhang JH, Mi JQ, Pui CH, Tang JY, Chen
Z, Chen SJ. Genomic profiling of adult and pediatric B-cell acute
lymphoblastic leukemia. Ebiomedicine. 2016;8:173-83.
27) Li JF, Dai YT, Lilljebjorn H, Shen SH, Cui BW, Bai L, Liu YF, Qian
MX, Kubota Y, Kiyoi H, Matsumura I, Miyazaki Y, Olsson L, Tan
AM, Ariffin H, Chen J, Takita J, Yasuda T, Mano H, Johansson
B, Yang JJ, Yeoh AEJ, Hayakawa F, Chen Z, Pui CH, Fioretos T,
Chen SJ, Huang JY. Transcriptional landscape of B cell precursor
acute lymphoblastic leukemia based on an international study of
1,223 cases. P Natl Acad Sci USA. 2018;115:E11711-20.
28) Yoshimoto T, Tanaka M, Homme M, Yamazaki Y, Takazawa
Y, Antonescu CR, Nakamura T. CIC-DUX4 induces small
round cell sarcomas distinct from ewing sarcoma. Cancer Res.
2017;77:2927-37.
29) Mayran A, Khetchoumian K, Hariri F, Pastinen T, Gauthier
Y, Balsalobre A, Drouin J. Pioneer factor Pax7 deploys a stable
enhancer repertoire for specification of cell fate. Nat Genet.
2018;50:259-69.
30) Bosnakovski D, Toso EA, Hartweck LM, Magli A, Lee HA,
Thompson ER, Dandapat A, Perlingeiro RCR, Kyba M. The
DUX4 homeodomains mediate inhibition of myogenesis and are
functionally exchangeable with the Pax7 homeodomain. J Cell
Sci. 2017;130:3685-97.
31) Jones TI, Chen JC, Rahimov F, Homma S, Arashiro P, Beermann
ML, King OD, Miller JB, Kunkel LM, Emerson CP Jr., Wagner
KR, Jones PL. Facioscapulohumeral muscular dystrophy family
studies of DUX4 expression: Evidence for disease modifiers
and a quantitative model of pathogenesis. Hum Mol Genet.
2012;21:4419-30.
32) Chau J, Kong X, Viet Nguyen N, Williams K, Ball M, Tawil R,
Kiyono T, Mortazavi A, Yokomori K. Relationship of DUX4 and
target gene expression in FSHD myocytes. Hum Mutat. 2021,
42:421-33.
33) Choi SH, Gearhart MD, Cui ZY, Bosnakovski D, Kim M,
Schennum N, Kyba M. DUX4 recruits p300/CBP through its
C-terminus and induces global H3K27 acetylation changes.
Nucleic Acids Res. 2016;44:5161-73.
34) Teveroni E, Pellegrino M, Sacconi S, Calandra P, Cascino I,
Farioli-Vecchioli S, Puma A, Garibaldi M, Morosetti R, Tasca
G, Ricci E, Trevisan CP, Galluzzi G, Pontecorvi A, Crescenzi M,
Deidda G, Moretti F. Estrogens enhance myoblast differentiation
in facioscapulohumeral muscular dystrophy by antagonizing
DUX4 activity. J Clin Invest. 2017;127:1531-45.
35) Hangul C, Bozkurt S, Bilge U, Ozdem S, Altunbas H, Uysal H,
Koc F, Karauzum S. The ratios of estradiol and progesterone
to testosterone influence the severity of facioscapulohumeral
muscular dystrophy. Neurol Sci Neurophysiol. 2020;37:190.
36) Hangul C, Celik E, Kaya H, Eroglu O, Uysal H, Karauzum S.
Estradiol differentially regulates DUX4, β -catenin and PAX3/
PAX7 in primary myoblasts of facioscapulohumeral muscular
dystrophy patients. Turkish Journal of Biochemistry. 2020.
37) Dixit M, Ansseau E, Tassin A, Winokur S, Shi R, Qian H, Sauvage
S, Matteotti C, van Acker AM, Leo O, Figlewicz D, Barro M,
Laoudj-Chenivesse D, Belayew A, Coppee F, Chen YW. DUX4,
a candidate gene of facioscapulohumeral muscular dystrophy,
encodes a transcriptional activator of PITX1. Proc Natl Acad Sci
U S A. 2007;104:18157-62.
38) Collins PC, Patel SD, Papoutsakis ET, Miller WM. Nucleisize
distributions as predictive tools of hematopoietic cell
proliferation. Cytotherapy. 1999;1:99-109.
39) Ferreboeuf M, Mariot V, Bessieres B, Vasiljevic A, Attie-Bitach T,
Collardeau S, Morere J, Roche S, Magdinier F, Robin-Ducellier J,
Rameau P, Whalen S, Desnuelle C, Sacconi S, Mouly V, Butler-
Browne G, Dumonceaux J. DUX4 and DUX4 downstream target
genes are expressed in fetal FSHD muscles. Hum Mol Genet.
2014;23:171-81.
40) Lemmers RJ, Tawil R, Petek LM, Balog J, Block GJ, Santen GW,
Amell AM, van der Vliet PJ, Almomani R, Straasheijm KR, Krom
YD, Klooster R, Sun Y, den Dunnen JT, Helmer Q, Donlin-Smith
CM, Padberg GW, van Engelen BG, de Greef JC, Aartsma-Rus
AM, Frants RR, de Visser M, Desnuelle C, Sacconi S, Filippova
GN, Bakker B, Bamshad MJ, Tapscott SJ, Miller DG, van der
Maarel SM. Digenic inheritance of an SMCHD1 mutation and
an FSHD-permissive D4Z4 allele causes facioscapulohumeral
muscular dystrophy type 2. Nat Genet. 2012;44:1370-4.