Material and Method: We identified 84 patients with grade II-IV glioma with IDH, ATRX, 1p / 19q and TERT status. All tumor samples were subjected to molecular genetic screening (Sanger sequencing for IDH and TERT mutations, fluorescence in situ hybridization for 1p/19q status) after histological diagnosis (immunohistochemistry for IDH1 R132H, ATRX, and p53) for a more precise molecular diagnosis. The confidence intervals were calculated at the 95% confidence level, and differences at p < 0.05 were considered statistically significant.
Results: Primary glioblastomas had the highest frequency of TERT promoter mutations (25 of 28, 89.2%, p=0.006) followed by oligodendrogliomas (29 of 35, 82.8%, p<0.001) while astrocytomas showed the lowest frequency (3 of 15, 20%, p=0.107), and the positivity significantly differed among these three groups (p<0.001). TERT promoter mutations were more frequent in patients older than 55 years of age at diagnosis (p=0.023). The group with TERT promoter mutations, and without IDH mutations showed the worst overall survival. However, the presence of both TERT promoter and IDH mutations, which resembled oligodendroglial progression, showed best overall survival (p=0.042).
Conclusion: The discovery of TERT promoter mutations in numerous gliomas has opened the door for a better molecular classification of gliomas, and TERT status is associated with survival. Further studies will help in elucidating the value of TERT promoter mutations as biomarkers in clinical practice, and eventual therapeutic targets.
TERT mutations are usually investigated by sequencing or real-time PCR [7], and TERT promoter mutations occur in 70-80% of glioblastomas (GBM), 95% of oligodendrogliomas (OD), and 10-25% of astrocytomas [5]. TERT promoter mutations are significantly inversely proportional to IDH1 / 2 mutations [8]. Changes in TERT and IDH are not only associated with specific histological glioma subgroups, but also are associated with a variable prognosis [9].
The literature on telomere-related mechanisms with glioma is rapidly increasing. Their prognostic and predictive roles are very interesting and may guide the clinical management of glioma patients. Yet, there are no studies investigating the distribution and significance of TERT promoter mutations in the WHO 2016 classification [10].
In the study conducted at Mayo Clinic, cases with 1 / 19q co-deletion, IDH mutation and TERT promoter mutation (triple-positive) were associated with an oligodendroglial phenotype and showed better overall survival (OS). Lowgrade tumors (II and III) showing TERT and IDH mutations without 1p19q co-deletion tended to have a prognosis similar to triple-positive cases [11]. However, patients without TERT and IDH mutations and those with 1p/19q co-deletion had very aggressive tumors and poor survival. Patients with wild-type (WT) TERT, IDH, and persevered 1p19q (triple negative) were associated with GBM, and had worse prognosis than triple-positive gliomas, but had a better prognosis than in patients with TERT mutations only [12].
Study Population
We identified 84 patients (32 females and 52 males) with
grade II-IV glioma with known IDH, ATRX, 1p / 19q
and TERT status. Fifty-seven patients had WHO grade
II-III tumors (24 oligodendrogliomas (OD), 14 anaplastic
ODs, 13 astrocytomas, 5 anaplastic astrocytomas, and
1 anaplastic oligoastrocytoma with a low grade glioma
component), and the remaining 27 samples represented
high grade glioma (WHO grade IV/GBM) (Table I).
Table I: Clinicopathological variables of the 84 diffuse glioma patients.
All tumor samples were subjected to molecular genetic screening after histological diagnosis for a more precise / molecular diagnosis [13,14]. Tumors in the astrocytoma group were characterized by detectable immunoreactivity for IDH1 (R132H), p53 and loss of immunoreactivity for ATRX [15]. All tumors in the OD group had IDH1 mutation (R132H) and 1p / 19q co-deletion. GBMs were IDH wild type (IDH-WT) [1].
Immunohistochemistry (IHC), Assessment of TERT
promoter and IDH Mutation, Fluorescence in situ
Hybridization (FISH)
Immunohistochemistry (IHC) was performed on at least
one representative block using primary antibody against
the following antigens- IDH1 R132H (Dianova, dilution
1:40), ATRX (Sigma, dilution 1:300), and p53 (Dako, dilution 1:50). Cases showing cytoplasmic positivity for
IDH1 in tumor cells were considered positive. Loss of
nuclear staining for ATRX in tumor cells (>90%) was
considered positive for ATRX mutation. Nuclear positivity
for p53 in >10% tumor cells was considered positive [16].
Mutations in the promoter region of TERT gene (chr5, 1,295,228C>T and 1,295,250C>T) and exon 4 of IDH1 and IDH2 genes (well-known hotspot regions for oncogenic mutations) were analyzed by PCR-based direct sequencing using representative formalin-fixed paraffin-embedded tumor samples. Tumor targets were manually microdissected from 5-μm thick unstained histological sections. After deparaffinization and rehydration, DNA was isolated from each target using QIAamp DNA FFPE Tissue Kit (50) (catalog #: 56404) (QIAGEN, Hilden, Germany) in accordance with the manufacturers instructions. DNA concentrations of samples were assessed spectrophotometrically using a Nanodrop 1000 spectrophotometer (Thermo Scientific, USA). PCR was performed in a Thermal Cycler (ABI, Applied Biosystems, USA) using HotStarTaq DNA Polymerase kit (catalog #: 203205) (QIAGEN, Hilden, Germany), and appropriate primers (TERT -Forward: 5CAGCGCTGCCTGAAACTC3, TERT -Reverse: 5GTCCTGCCCCTTCACCTT3, IDH1 exon 4-Forward: 5 CCAAGTCACCAAGGATGCTG3, IDH1 exon 4-Reverse: 5 TCACATTACTGCCAACATGACTT3, IDH2 exon 4-Forward: 5 CCGTCTGGCTGTGTTGTTG3, and IDH2 exon 4-Reverse: 5 AGTCTGTCGCCTTGTACTGC3).
PCR reactions were run as total volume of 50 μl reaction mixtures consisting of nuclease free water, 5 μl 10x PCR Buffer, 10 μl Q solution (for TERT), 1.5 μl 10 mM dNTP mix (ABI, Applied Biosystems, USA), 2 μl 25 mM MgCl2 (for IDH1 and IDH2), 7 μl (for TERT) and 6 μl (for IDH1 and IDH2) of each primer (4pmol/μl), 0.25 μl of Hot Start Taq DNA polymerase, and 50 ng of each tumor DNA. After an initial denaturation at 95°C for 15 minutes, 42 cycles were performed of 30 seconds denaturation at 95°C, 30 seconds annealing at 55°C (for TERT), and at 58°C (for IDH1 and IDH2), and 45 seconds extension at 72°C, followed by a final extension of 10 minutes at 72°C. The intensity of the PCR products were checked by running 5 μl of each PCR reaction with 2 μl of loading dye on a 2% agarose gel. Reagent contamination control was achieved by examining the lane for No DNA blank tube. Then, all succeeded PCR products were purified using the QIAquick PCR Purification Kit (catalog #: 28106) (QIAGEN, Hilden, Germany) according to the manufacturers instructions. The purified amplicons were submitted to direct sequencing in both directions (forward and reverse) using reagents from the Big Dye Terminator v3.1 Cycle Sequencing kit (ABI, Applied Biosystems, USA) in accordance with the manufacturers protocol. After ethanol precipitation, subsequent products were run on the ABI-3730 (48 capillary) automatic sequencer (Applied Biosystems, USA). Bidirectional sequence traces were analyzed with SeqScape® Software v3.0 (Applied Biosystems, USA), and manually reviewed.
FISH analysis was performed on 5-micron-thick formalin fixed paraffin-embedded tissue samples. Deparaffinization, pre-hybridization and hybridization steps were conducted according to the datasheet. One hundred tumors cells were analyzed on the fluorescent microscope (Olympus BX61; Olympus Optical, Japan). The cells were captured on a computer system with a digital camera (XLMM, Dage- MTI, IN, USA), and compatible software (Duet®, Bioview Ltd., Israel). Dual-color paired probes for 1p and 1q (1p36 Spectrum Orange and 1q25 Spectrum Green, Vysis LSI probes, Abbott Molecular, Des Plaines, IL) were hybridized simultaneously on one slide, and similarly those for 19q, and 19p (19q13 Spectrum Orange and 19p13 Spectrum Green, Vysis LSI probes, Abbott Molecular, Des Plaines, IL) were used on a separate slide. A proportion is used due to the fact that a significant number of nuclei would have reduced comparison/control (green) signals because of tissue sectioning removing portions of the nuclei. Based on laboratory experience, a proportion <0.80 was considered as a deletion. The ratio of SpectrumOrange to SpectrumGreen signals (total orange/total green) was calculated.
Statistical Analysis
Statistical analyses were performed using IBM SPSS
Statistics for Windows, Version 21.0. (IBM Corp., Armonk,
NY). Descriptive statistics were used to describe the data.
Normal distribution was tested by the Kolmogorov-
Smirnov and Shapiro-Wilk tests. Non-parametric data were
compared using the Chi-square test. The Kaplan-Meier
method was used for survival analysis, and the log-rank
test (Mantel-Cox) was performed to compare the survival
curves between the groups. The confidence intervals were
calculated at the 95% confidence level and differences at p
<0.05 were considered statistically significant.
TERT Promoter Mutations and Alterations in
Other Genes
Overall, TERT promoter mutations were present in 57
of 84 (67.9%) gliomas [20 (60.6%) in grade II, 12 (66.6%)
in grade III, and 25 (92.5%) in grade IV]. The C228T
mutation was detected in 42 tumors (53.8%), whereas the
C250T mutation was found in 15 cases (19.2%), supporting
the predominance of the C228T mutation in glioma.
Primary glioblastomas had the highest frequency of TERT
promoter mutations (25/28; 89.2%, p=0.006) followed
by oligodendrogliomas (29/35; 82.8%, p<0.001), while
astrocytomas showed the lowest frequency, with 3 out of
15 (20%, p=0.107) samples showing mutations (Table II).
TERT promoter mutations were found to be associated
with high grade (grade III/IV) tumors when compared to
lower grade (grade II) lesions (p<0.033), and were more
frequent in patients older than 55 years of age (p=0.023).
A statistically significant association was observed between
the TERT mutation and the diagnosis (p<0.001). We
performed post hoc power analysis by G*Power 3.1.9.2.
The Type II error (β) probability was less than 0.01 (power
>0.99) for the combined diagnostic algorithm (Figure 1).
Table II: The frequency of TERTp mutations.
IDH gene mutations were present in 44 tumors (42 of these being IDH1 R132H mutations). Twenty-nine of these (corresponding to oligodendrogliomas) harbored a concomitant 1p/19q co-deletion, and all of them except three were also TERT promoter mutant.
The TERT p mutation and IDH mutation were more highly associated compared to TERT p with IDH-WTs (P<0.001 and p=0.655, respectively). However, in oligodendroglial tumors, TERT promoter and IDH mutations occurred together (p<0.001). 24 of 26 IDH/TERT double mutant tumors had the 1p/19q co-deletion. In primary glioblastomas, there were no IDH mutations, as expected. In astrocytomas, TERT promoter and IDH mutations were both found in only 2 of 15 cases (Figure 2).
Figure 2: Molecular classification of diffuse glioma and frequency of each subgroup in our study.
Moreover, TERTp and TP53 mutations in low-grade and anaplastic gliomas were mutually exclusive, where none and 5.5% of TERT mutated tumors harbored TP53 mutations, respectively. A statistically significant association was observed between the TERT mutation and p53 mutation (p<0.001).
TERT promoter mutations were mutually exclusive with ATRX deficiency. However, no statistically significant association was observed between the TERT mutation and ATRX mutation (p=0.533).
Effect of TERT Promoter Mutations on Survival
Results of the Kaplan-Meier survival analysis are shown in
Figure 3A,B.
The overall cumulative survival in cases with TERT mutation was 64.94 months (95% CI=55.58-74.31) and overall cumulative survival in cases without TERT mutation was 46.80 months (95% CI=37.71-55.89) (p=0.870) (Figure 3B). Patients carrying the C250T mutation had slightly longer survival compared to patients with the C228T mutation (78.5% and 76.9%).
Moreover, the TERT mutation frequency, both C228T and C250T, increased with age: <40 years: 65.5% (19/29); 40-55 years: 66.6% (20/30), and >55 years: 94.7% (18/19). Compared to patients with WT- TERT, younger patients with TERT mutation survived longer, but patients with TERT mutation who were aged >55 years had shorter survival.
Stratification of the patients based on the mutational status of TERT promoter and IDH resulted in three groups with different overall survival. The group with TERT promoter mutations and no IDH mutations had the worst overall survival (median survival 12.29 months), the 2nd worst overall survival rate was the group without TERT and IDH mutations (median survival 24 months). Best overall survival was associated with the presence of both TERT promoter and IDH mutations (median survival 38.07 months), which resembles oligodendroglial progression (p=0.042).
Survival analysis in patients with primary glioblastomas did not reveal any effect of the TERT promoter mutations. Both patients with and without TERT promoter mutations had a median survival of 12 months (Figure 3A).
In diffuse and anaplastic gliomas that showed TERT promoter mutations were associated with poor survival while 1p/19q co-deletions had a favorable effect. Survival in gliomas with a TERT mutation and 1p19q co-deletion (median survival 58.2 months) was higher than in those without TERT mutation and 1p19q codeletion (median survival 42 months).
Recent studies have shown that this classification has certain limitations for precise prediction of clinical outcomes and strategies for gene target therapy [16]. Therefore, a more objective glioma classification is needed to guide diagnosis and treatment strategies.
Telomeres are structures at the end of eukaryotic chromosomes and are responsible for the deterioration of chromosomes, end-to-end fusion, and protection from rearrangement [17]. Telomerase maintains the appropriate telomere length by adding repeated telomeric sequences to the 3 ends of the telomeres. Abnormal telomerase activity plays a role in the initiation and development of cancer and other diseases related to aging [18]. TERT is overexpressed in many human cancers [19]. TERT promoter mutations were first found in melanoma and were thought to represent the tumorigenic mechanism [16].
The discovery of TERT p mutations in numerous gliomas has opened the door for a better molecular classification of gliomas in 2013 [20,21]. TERT promoter mutations occur in 70-80% of glioblastomas, 95% of oligodendrogliomas, and 10-25% of astrocytomas [5,7,11].
The prevalence of TERT promoter mutations associated with various histological categories was similar to other studies [22,23]. As expected, IDH-mutant tumors were prevalent predominantly in younger adults, while all IDH-WT/ TERT -mutant tumors apart from a single pediatric tumor occurred in adults. Our findings are consistent with the concept that IDH-WT/ TERTmutant diffuse gliomas represent a clinicopathological part of primary glioblastomas and their precursors [24,25]. In any case, inclusion of TERT promoter mutation analysis into a diagnostic molecular panel shifts the vast majority of otherwise marker-negative diffuse gliomas into a biologically plausible category. Furthermore, TERT promoter mutation status is of prognostic significance not only in diffuse gliomas with non-glioblastoma histology [11,25], but also in glioblastoma [10,26]. The present study demonstrates that adding the TERT promoter mutation status to standard markers, as suggested in the literature, results in a precise molecularly directed classification with IDH-WT/ TERT -mutant tumors representing the primary glioblastoma group [27].
Age was another parameter for survival. Patients aged >55 years who had TERT mutation had worse survival compared to patients without the mutation.
In the whole cohort, patients with C250T mutations tended to have longer survival compared to patients with C228T mutations. We found that occurrence of the C228T and C250T mutations were mutually exclusive in our cohort, and that C228T (84.2%) was more common than C250T (15.8%).
With rare exceptions, TERT promoter mutations [8], which lead to an increase in telomerase expression, and inactivating mutations in the thalassemia/mental retardation syndrome X-linked (ATRX) gene, are mutually exclusive, and are associated with different molecular tumor subclasses [28]. Our study was the exception for mutual relationship of ATRX and TERT mutations, as we could not find any significant relationship (p=0.533). On the other hand, our study demonstrated that TERT promoter mutations have a significant inverse association with P53 mutation (p<0.001), similar to previous studies [17].
TERT promoter mutations have been reported to be associated with aggressive behavior and poor outcome in various types of cancers [3]. In this study, prognosis in glioblastoma cases with TERT mutation was worse than in oligodendrogliomas with TERT mutation. Cases with TERT mutation had a worse prognosis than cases without TERT mutation, but none of the relevant results in our study had statistical significance.
The combination of TERTp and IDH mutational status was a significant prognostic factor in grade II and III gliomas; this finding of a specific association between IDH/ TERTp group and low-grade glioma is consistent with results from a previous study [20,29]. Eckel-Passow et al. [12] showed that patients with IDH-WT/TERTp-WT have poorer overall survival when compared with patients with IDHmutated/ TERTp or IDH mutation alone, but showed better overall survival when compared with patients with IDHWT/ TERTp-mutation [11]. A recently published metaanalysis also suggested that combined TERTp-mutated/ IDH-WT testing could act as a significant biomarker for poor prognosis in grade II and III gliomas [20].
Given that 67.9% of tumours being TERTp-mut, TERT is the most frequently mutated gene in gliomas thus far identified [5,8,30-32]. Our data confirm the high frequency of TERTp-mutation in gliomas, and show that these mutations clusterise into specific entities, with distinct clinical significances.
In previous studies, the 1p/19q co-deletion was strongly associated with mutations in TERTp [33,34]. In the present study, we found that 96.9% of patients with oligodendrogliomas had a TERTp mutation, whereas two patients with oligodendroglioma were TERTp-WT. On the contrary, there was a high frequency of TERTp mutation in cases with GBM that did not harbor the 1p/19q co-deletion, and therefore we conclude that the TERTp mutation is not exclusively associated with the 1p/19q co-deletion.
Regarding the TERTp mutation from a prognostic perspective in diffuse gliomas, previous studies have shown conflicting results. Labussiere et al. have found that TERTp mutations may be associated with poorer outcome in highgrade gliomas [31], however, Pekmezci et al. have reported that TERT-mutants had significantly worse survival only in IDH-WT astrocytoma, which includes grades II and III [10]. Such contradictory effects of TERTp mutation on patient outcome between groups have been reported previously [11]. Aibaidula et al. found comparable results to those of Pekmezci et al., and concluded that adult IDHWT lower-grade gliomas should be further classified by TERTp mutation status [35].
According to Cimpact now update 3, IDH wild type diffuse or anaplastic astrocytomas will have a worse prognosis as grade IV glioblastomas. The following molecular methods can be used to distinguish these cases: EGFR amplification, losses of chromosome 10 (whole chromosome, 10p or 10q), gains of chromosome 7 (whole chromosome, 7p or 7q), TERT promoter mutations, homozygous deletion of CDKN2A/B, and large-scale, microarray based DNA methylation profiling. According to the results of the current study, histologic IDH-wildtype diffuse astrocytic gliomas of WHO grade II or III that carry EGFR amplification, +7/−10 or TERT promoter mutation are associated with significantly shorter survival compared to patients with other WHO grade II or III gliomas, and outcomes are similar to those in patients with IDHwildtype glioblastoma [27]. Molecular studies other than TERT promoter mutation could not be performed, and this is a limitation of our study. We aim to fill this gap in future studies.
IDH mutation was detected in 16 cases with midline localization in our study and their grade was II. In these cases, which are known to have a good prognosis in followup, diffuse midline glioma was evaluated by considering it in the differential diagnosis. However, H3F3A K27M mutation could not be detected with immunohistochemical or molecular methods.
TERT promoter mutations were shown to have inverse prognostic effects in IDH-mut and IDH-WT WHO grade II/III gliomas. Our study strongly supports using TERT and IDH genotyping in WHO grade II/III gliomas as a reliable and reasonable test that can help clinicians predict patient outcome more precisely than using only conventional histology, or TERT or IDH status alone. It is important to note that gliomas with concurrent TERT promoter and IDH mutations are almost always accompanied with 1p19q co-deletion, which is the hallmark of oligodendroglioma according to the WHO classification 2016, and it can help to explain why gliomas with coexisting IDH and TERT promoter mutations are most likely associated with favorable outcome.
Data suggest that patients with TERT promoter mutations in tumors probably require more aggressive treatment than their WT counterparts. Further studies will help elucidating the value of TERT promoter mutations as biomarkers in clinical practice and eventual therapeutic targets. Expression data and an association with shorter telomeres already strongly indicate the role of the TERT promoter mutations not only in glioma, but in many other cancer types, and future functional studies will aid in placing the TERT promoter mutations into the right context.
CONFLICT of INTEREST
The authors declare that they have no conflict of interest.
FUNDING
This study was supported by the University of Health
Sciences Scientific Research Unit (Project number
2018/064).
ACKNOWLEDGEMENTS
The statistical part of the study was conducted by specialist
pediatrician doctor Ersin Tural.
AUTHORSHIP CONTRIBUTIONS
Concept: NKT, IY, BO, Design: NKT, IY, BO, Data
collection or processing: NKT, Analysis or Interpretation:
NKT, IY, BO, Literature search: NKT, IY, BO, Writing:
NKT, IY, BO, Approval: NKT, IY, BO.
1) Louis DN, Perry A, Reifenberger G, von Deimling A, Figarella-
Branger D, Cavenee WK, Ohgaki H, Wiestler OD, Kleihues P,
Ellison DW. The 2016 World Health Organization Classification
of tumors of the central nervous system: A summary. Acta
Neuropathol. 2016;131:803-20.
2) Louis DN, Ohgaki H, Wiestler OD, Cavenee WK, Burger
PC, Jouvet A, Scheithauer BW, Kleihues P. The 2007 WHO
classification of tumours of the central nervous system. Acta
Neuropathol. 2007;114:97-109.
3) Vuong HG, Altibi AMA, Duong UNP, Ngo HTT, Pham TQ,
Chan AK, Park CK, Fung KM, Hassell L. TERT promoter
mutation and its interaction with IDH mutations in glioma:
Combined TERT promoter and IDH mutations stratifies lowergrade
glioma into distinct survival subgroups-A meta-analysis of
aggregate data. Crit Rev Oncol Hematol. 2017;120:1-9.
4) Horn S, Figl A, Rachakonda PS, Fischer C, Sucker A, Gast A,
Kadel S, Moll I, Nagore E, Hemminki K, Schadendorf D, Kumar
R. TERT promoter mutations in familial and sporadic melanoma.
Science. 2013; 339:959-61.
5) Arita H, Narita Y, Fukushima S, Tateishi K, Matsushita Y,
Yoshida A, Miyakita Y, Ohno M, Collins VP, Kawahara N,
Shibui S, Ichimura K. Upregulating mutations in the TERT
promoter commonly occur in adult malignant gliomas and are
strongly associated with total 1p19q loss. Acta Neuropathol.
2013;126:267-76.
6) Otani R, Uzuka T, Ueki K. Classification of adult diffuse gliomas
by molecular markers-a short review with historical footnote. Jpn
J Clin Oncol. 2017;47:2-6.
7) Pesenti C, Paganini L, Fontana L, Veniani E, Runza L, Ferrero S,
Bosari S, Menghi M, Marfia G, Caroli M, Silipigni R, Guerneri
S, Tabano S, Miozzo M. Mass spectrometry-based assay for
the molecular diagnosis of glioma: Concomitant detection of
chromosome 1p/19q codeletion, and IDH1, IDH2, and TERT
mutation status. Oncotarget. 2017;8:57134-48.
8) Killela PJ, Pirozzi CJ, Healy P, Reitman ZJ, Lipp E, Rasheed
BA, Yang R, Diplas BH, Wang Z, Greer PK, Zhu H, Wang CY,
Carpenter AB, Friedman H, Friedman AH, Keir ST, He J, He Y,
McLendon RE, Herndon JE 2nd, Yan H, Bigner DD. Mutations in
IDH1, IDH2, and in the TERT promoter define clinically distinct
subgroups of adult malignant gliomas. Oncotarget. 2014;5:1515-25.
9) Ceccarelli M, Barthel FP, Malta TM, Sabedot TS, Salama SR,
Murray BA, Morozova O, Newton Y, Radenbaugh A, Pagnotta
SM, Anjum S, Wang J, Manyam G, Zoppoli P, Ling S, Rao AA,
Grifford M, Cherniack AD, Zhang H, Poisson L, Carlotti CG Jr,
Tirapelli DP, Rao A, Mikkelsen T, Lau CC, Yung WK, Rabadan
R, Huse J, Brat DJ, Lehman NL, Barnholtz-Sloan JS, Zheng S,
Hess K, Rao G, Meyerson M, Beroukhim R, Cooper L, Akbani R,
Wrensch M, Haussler D, Aldape KD, Laird PW, Gutmann DH;
TCGA Research Network, Noushmehr H, Iavarone A, Verhaak
RG. Molecular profiling reveals biologically discrete subsets and
pathways of progression in diffuse glioma. Cell. 2016;164:550-63.
10) Pekmezci M, Rice T, Molinaro AM, Walsh KM, Decker PA,
Hansen H, Sicotte H, Kollmeyer TM, McCoy LS, Sarkar G, Perry
A, Giannini C, Tihan T, Berger MS, Wiemels JL, Bracci PM,
Eckel-Passow JE, Lachance DH, Clarke J, Taylor JW, Luks T,
Wiencke JK, Jenkins RB, Wrensch MR. Adult infiltrating gliomas
with WHO 2016 integrated diagnosis: Additional prognostic
roles of ATRX and TERT. Acta Neuropathol. 2017;133:1001-16.
11) Eckel-Passow JE, Lachance DH, Molinaro AM, Walsh KM,
Decker PA, Sicotte H, Pekmezci M, Rice T, Kosel ML, Smirnov
IV, Sarkar G, Caron AA, Kollmeyer TM, Praska CE, Chada AR,
Halder C, Hansen HM, McCoy LS, Bracci PM, Marshall R, Zheng
S, Reis GF, Pico AR, ONeill BP, Buckner JC, Giannini C, Huse JT,
Perry A, Tihan T, Berger MS, Chang SM, Prados MD, Wiemels J,
Wiencke JK, Wrensch MR, Jenkins RB. Glioma Groups Based on
1p/19q, IDH, and TERT Promoter Mutations in Tumors. N Engl
J Med. 2015;372:2499-508.
12) Labreche K, Kinnersley B, Berzero G, Di Stefano AL, Rahimian
A, Detrait I, Marie Y, Grenier-Boley B, Hoang-Xuan K, Delattre
JY, Idbaih A, Houlston RS, Sanson M. Diffuse gliomas classified
by 1p/19q co-deletion, TERT promoter and IDH mutation status
are associated with specific genetic risk loci. Acta Neuropathol.
2018;135:743-55.
13) Masui K, Mischel PS, Reifenberger G. Molecular classification of
gliomas. Handb Clin Neurol. 2016;134:97-120.
14) Reuss DE, Sahm F, Schrimpf D, Wiestler B, Capper D, Koelsche C,
Schweizer L, Korshunov A, Jones DT, Hovestadt V, Mittelbronn
M, Schittenhelm J, Herold-Mende C, Unterberg A, Platten M,
Weller M, Wick W, Pfister SM, von Deimling A. ATRX and
IDH1-R132H immunohistochemistry with subsequent copy
number analysis and IDH sequencing as a basis for an integrated
diagnostic approach for adult astrocytoma, oligodendroglioma
and glioblastoma. Acta Neuropathol. 2015;129:133-46.
15) Roshandel AK, Busch CM, Mullekom JV, Cuoco JA, Rogers
CM, Apfel LS, Marvin EA, Sontheimer HW, Umans RA. The
predictive capability of immunohistochemistry and DNA
sequencing for determining TP53 functional mutation status:
A comparative study of 41 glioblastoma patients. Oncotarget.
2019;10:6204-18.
16) Walsh KM, Wiencke JK, Lachance DH, Wiemels JL, Molinaro
AM, Eckel-Passow JE, Jenkins RB, Wrensch MR. Telomere
maintenance and the etiology of adult glioma. Neuro Oncol.
2015;17:1445-52.
17) You H, Wu Y, Chang K, Shi X, Chen XD, Yan W, Li R. Paradoxical
prognostic impact of TERT promoter mutations in gliomas
depends on different histological and genetic backgrounds. CNS
Neurosci Ther. 2017;23:790-7.
18) Zhou P, Wei L, Xia X, Shao N, Qian X, Yang Y. Association between
telomerase reverse transcriptase rs2736100 polymorphism and
risk of glioma. J Surg Res. 2014;191:156-60.
19) Gillis AJ, Schuller AP, Skordalakes E. Structure of the Tribolium
castaneum telomerase catalytic subunit TERT. Nature.
2008;455:633-7.
20) Stewart SA, Weinberg RA. Telomeres: Cancer to human aging.
Annu Rev Cell Dev Biol. 2006;22:531-57.
21) Kim HS, Kwon MJ, Song JH, Kim ES, Kim HY, Min KW. Clinical
implications of TERT promoter mutation on IDH mutation and
MGMT promoter methylation in diffuse gliomas. Pathol Res
Pract. 2018;214:881-8.
22) Killela PJ, Reitman ZJ, Jiao Y, Bettegowda C, Agrawal N, Diaz
LA Jr, Friedman AH, Friedman H, Gallia GL, Giovanella BC,
Grollman AP, He TC, He Y, Hruban RH, Jallo GI, Mandahl
N, Meeker AK, Mertens F, Netto GJ, Rasheed BA, Riggins
GJ, Rosenquist TA, Schiffman M, Shih IeM, Theodorescu
D, Torbenson MS, Velculescu VE, Wang TL, Wentzensen
N, Wood LD, Zhang M, McLendon RE, Bigner DD, Kinzler
KW, Vogelstein B, Papadopoulos N, Yan H. TERT promoter
mutations occur frequently in gliomas and a subset of tumors
derived from cells with low rates of self-renewal. Proc Natl Acad
Sci U S A. 2013;110:6021-6.
23) Yang P, Cai J, Yan W, Zhang W, Wang Y, Chen B, Li G, Li S, Wu
C, Yao K, Li W, Peng X, You Y, Chen L, Jiang C, Qiu X, Jiang
T; CGGA project. Classification based on mutations of TERT
promoter and IDH characterizes subtypes in grade II/III gliomas.
Neuro Oncol. 2016;18:1099-108.
24) Brandner S, von Deimling A. Diagnostic, prognostic and predictive
relevance of molecular markers in gliomas. Neuropathol Appl
Neurobiol. 2015;41:694-720.
25) Neumann JE, Dorostkar MM, Korshunov A, Mawrin C, Koch
A, Giese A, Schüller U. Distinct Histomorphology in Molecular
Subgroups of Glioblastomas in Young Patients. J Neuropathol
Exp Neurol. 2016;75:408-14.
26) Hewer E, Prebil N, Berezowska S, Gutt-Will M, Schucht P,
Dettmer MS, Vassella E. Diagnostic implications of TERT
promoter mutation status in diffuse gliomas in a routine clinical
setting. Virchows Arch. 2017;471:641-9.
27) Brat DJ, Aldape K, Colman H, Holland EC, Louis DN, Jenkins
RB, Kleinschmidt-DeMasters BK, Perry A, Reifenberger G,
Stupp R, von Deimling A, Weller M. cIMPACT-NOW update 3:
Recommended diagnostic criteria for Diffuse astrocytic glioma,
IDH-wildtype, with molecular features of glioblastoma, WHO
grade IV. Acta Neuropathol. 2018;136:805-10.
28) Arita H, Yamasaki K, Matsushita Y, Nakamura T, Shimokawa A,
Takami H, Tanaka S, Mukasa A, Shirahata M, Shimizu S, Suzuki
K, Saito K, Kobayashi K, Higuchi F, Uzuka T, Otani R, Tamura
K, Sumita K, Ohno M, Miyakita Y, Kagawa N, Hashimoto N,
Hatae R, Yoshimoto K, Shinojima N, Nakamura H, Kanemura Y,
Okita Y, Kinoshita M, Ishibashi K, Shofuda T, Kodama Y, Mori
K, Tomogane Y, Fukai J, Fujita K, Terakawa Y, Tsuyuguchi N,
Moriuchi S, Nonaka M, Suzuki H, Shibuya M, Maehara T, Saito
N, Nagane M, Kawahara N, Ueki K, Yoshimine T, Miyaoka E,
Nishikawa R, Komori T, Narita Y, Ichimura K. A combination
of TERT promoter mutation and MGMT methylation status
predicts clinically relevant subgroups of newly diagnosed
glioblastomas. Acta Neuropathol Commun. 2016;4:79.
29) Heaphy CM, de Wilde RF, Jiao Y, Klein AP, Edil BH, Shi C,
Bettegowda C, Rodriguez FJ, Eberhart CG, Hebbar S, Offerhaus
GJ, McLendon R, Rasheed BA, He Y, Yan H, Bigner DD, Oba-
Shinjo SM, Marie SK, Riggins GJ, Kinzler KW, Vogelstein B,
Hruban RH, Maitra A, Papadopoulos N, Meeker AK. Altered
telomeres in tumors with ATRX and DAXX mutations. Science.
2011;333:425.
30) Chan AK, Yao Y, Zhang Z, Chung NY, Liu JS, Li KK, Shi Z,
Chan DT, Poon WS, Zhou L, Ng HK. TERT promoter mutations
contribute to subset prognostication of lower-grade gliomas.
Mod Pathol. 2015;28:177-86.
31) Labussière M, Di Stefano AL, Gleize V, Boisselier B, Giry
M, Mangesius S, Bruno A, Paterra R, Marie Y, Rahimian A,
Finocchiaro G, Houlston RS, Hoang-Xuan K, Idbaih A, Delattre
JY, Mokhtari K, Sanson M. TERT promoter mutations in gliomas,
genetic associations and clinico-pathological correlations. Br J
Cancer. 2014;111:2024-32.
32) Liu X, Wu G, Shan Y, Hartmann C, von Deimling A, Xing M.
Highly prevalent TERT promoter mutations in bladder cancer
and glioblastoma. Cell Cycle. 2013;12:1637-8.
33) Kaloshi G, Benouaich-Amiel A, Diakite F, Taillibert S, Lejeune
J, Laigle-Donadey F, Renard MA, Iraqi W, Idbaih A, Paris S,
Capelle L, Duffau H, Cornu P, Simon JM, Mokhtari K, Polivka M,
Omuro A, Carpentier A, Sanson M, Delattre JY, Hoang-Xuan K.
Temozolomide for low-grade gliomas: Predictive impact of 1p/19q
loss on response and outcome. Neurology. 2007;68:1831-6.
){kind=link}
){kind=link}
){kind=link}
){kind=link}
){kind=link}