SCImago Journal & Country Rank
This journal is a member of, and subscribes to the principles of, the Committee on Publication Ethics (COPE)
2006, Volume 22, Number 1, Page(s) 057-060
[ Abstract ] [ PDF ] [ Similar Articles ] [ E-Mail to Editor ]
Cytologic diagnosis of toxoplasma gondii lymphadenitis: A case report
Aptullah HAHOLU1, Şükrü YILDIRIM1, Özgür KORU2, Nurittin ARDIÇ3, Hüseyin BALOĞLU1
1GATA Haydarpaşa Eğitim Hastanesi Patoloji Servis Şefliği, İstanbul
2GATA Askeri Tıp Fakültesi Mikrobiyoloji ve Klinik Mikrobiyoloji Anabilim Dalı, Parazitoloji Bilim Dalı, İstanbul
3GATA Haydarpaşa Eğitim Hastanesi Mikrobiyoloji ve Klinik Mikrobiyoloji Servis Şefliği, İstanbul
Keywords: Toxoplasma lymphadenitis, cytology
Abstract
The aim of this study is to present cytologic features of fine needle aspiration (FNA) of lymph node suggesting toxoplasmosis with demonstration of histiocytes containing tissue bradyzoites. A 3-year-old female presented with a mobile, tender, 3 cm diameter swelling in submandibular region. FNA smears showed features of reactive lymphoid hyperplasia with polymorphic cells including groups of histiyocytes. Many epitelioid histiocytes containing intracytoplasmic particules suggesting toxoplasma bradyzoites were also seen in a Papanicolaou -stained smear. Although serologic tests did not reveal a high titer of IgG and IgM-specific antibodies to Toxoplasma gondii, the diagnosis of Toxoplasma lymphadenitis was confirmed by demonstrating the sequence specific for toxoplasma genom of the DNA in the material scraped from the stained slides with PCR technique. FNA cytology is a valuable diagnostic tool for toxoplasma lymphadenitis, which especially demonstrates epithelioid histiocytes containing tissue bradyzoites. Although serology may not be supportive, PCR study may confirm the diagnosis.
Introduction
Toksoplazmozis, T. gondii'nin neden olduğu yaygın olarak görülen bir parazitik hastalıktır. Yaygın olarak memelileri ve kuşları enfekte eden bu parazitin son konağı kedidir. İnsanlar ve diğer memeliler ara konaktır. Kedi dışkısı ile doğal ortama saçılan parazit yumurtalarının kontamine topraktan ya da az pişirilmiş etlerden ağız yolu ile alınması ile hastalık insanlara geçer. Parazit yumurtaları alındıktan sonra makrofajlar içinde lenfatiklerle ve kan yolu ile yayılır1. Makrofajlara girdiklerinde hızla bölünmeye başlar ve bu süre içerisinde hümoral ve hücresel immün sistemden saklanır. Klinik olarak, eğer immün yetmezlik durumu söz konusu değilse parazit çoğunlukla toksoplazma lenfadeniti şeklinde ortaya çıkar. Ilık ve nemli iklimlerde yaygın olan bu infeksiyon, genellikle asemptomatik seyreder. İnsanların çoğunda toksoplazmaya karşı antikor gelişmiştir. Bu çalışmada, submandibuler lenfadenomegali şeklinde ortaya çıkan ve iğne aspirasyonunda histiyositlerin sitoplazması nda parazitin görüldüğü bir olgu sunulmaktadır.
  • Top
  • Abstract
  • Introduction
  • Case Presentation
  • Disscussion
  • References
  • Case Presentation
    Üç yaşında kız çocuğu submandibuler kitle nedeniyle ailesi tarafından muayeneye getirildi. Fizik muayenede, submandibuler bölgede 3 cm çapında, bir adet hareketli, hafif derecede ağrılı lenfadenomegali saptandı. Nodülden yapılan iğne aspirasyonu materyalinden sitolojik inceleme için konvansiyonel yaymalar hazırlandı ve Papanicolaou tekniği ile boyanıp ışık mikroskopu ile incelendi. Hipersellüler aspiratta, matür lenfoid hücrelerin yanı sıra çok sayıda büyük nükleuslu, geniş sitoplazmalı histiyositler izlendi (Resim 1a). Büyük büyütmede histiyositlerin sitoplazmasında çok sayıda toksoplazma bradizoidleri saptandı (Resim 1b). Hastanın kan örneklerinde seropozitiflik saptanmamasına karşı n, sitolojik inceleme için hazırlanan boyalı lamlardan birinin kazınması ile elde edilen örnekten total genomik DNA izole edilerek yapılan PCR’da, T. gondii genomuna spesifik TOGO- 1 (GGAACTGCATCCGTTCATGAG) ve TOGO-2 (CAGACGAATCAACGGAACTG) sekanslarının varlığını gösteren 501 bp' lik DNA bandının agaroz jel elektroforezinde görülmesi ile toksoplazma lenfadeniti tanısı desteklendi. (Resim 2).


    Click Here to Zoom
    Resim 1: a-Polimorfik hücreler içeren yayma (Papanicolaou x200), b-Sitoplazmasında T. gondii bradizoidleri bulunduran histiyosit (Papanicolaou x600).


    Click Here to Zoom
    Resim 2: Sitolojik örnekten amplifiye edilen T. gondii spesifik DNA sekansının (501 bp) agaroz jel elektroforez görüntüsü. M: DNA boyut eşeli. PK: T. gondii için pozitif kontrol. NK: Negatif kontrol. T: Test materyali.

  • Top
  • Abstract
  • Introduction
  • Case Presentation
  • Disscussion
  • References
  • Discussion
    Toksoplazmozis çok yaygın bir parazitik hastalık olmasına karşın genellikle subklinik seyreder. İmmün yetmezlik durumlarında ise, aralarında merkezi sinir sistemininde bulunduğu pek çok sistem ve organda yaygın hastalığa yol açabilir. Hamilelerde parazitin transplasental geçişi nedeni ile konjenital infeksiyon görülebilir1,2. Normal bireylerde ise en sık rastlanan klinik belirti lokalize lenfadenopatidir. Tamamen asemptomatik olduğu gibi ateş, miyalji gibi hafif semptomlarda birlikte de görülebilir. Toksoplazmanın, özellikle servikal bölgede meydana gelen ve klinik olarak açıklanamayan lenfadenopatilerin %15-20'sinde etiyolojik etken olduğu düşünülmektedir1. En sık olarak posterior servikal lenf nodları tutulur, ancak diğer servikal bölge lenf nodları, supraklavikular ve oksipital lenf nodlarının tutulumu da sıktır. Shimizu ve ark.'ları intramammar lenf nodunda toksoplazma lenfadeniti bildirmişlerdir3. Lenf nodları palpasyonla hafif ağrılı ya da ağrısız olabilir, hafif sert kıvamlı olarak ele gelebilir. Lenfadenomegali birkaç gün gibi kısa bir sürede geçebileceği gibi, bir yıldan uzun da sürebilir.

    Lenfadenopatilerin ayırıcı tanısı klinik ve patolojik açıdan oldukça önemlidir. Özellikle malignite kuşkusu bulunan lezyonların tanısında klinik ve patolojik korelasyon gereklidir. Çalışmamıza konu olan hastanın yaşı özellikle bazı lenfoid malignitelerin sık görüldüğü bir yaş grubuna uymaktadır. Lenfadenopatinin ön plana çıktığı, ağrısız ve sert bir kitle olarak kendini gösteren bu lenfoid maligniteler (prekürsor B veya T hücreli lenfoblastik lenfoma/lösemiler vb) ayırıcı tanıda akla getirilmelidir. Öte yandan birçok enfeksiyon etkeninin de bu yaş grubunda ve bu bölgede ortaya çıkan lenfadenopatilerle kendini gösterdiği düşünüldüğünde, bu bölgedeki lenfadenopatilerin spesifik tanısının ne kadar önemli olduğu ortaya çıkmaktadır.

    Sitolojik inceleme tanı amaçlı rutin bir yöntemdir. Bizim hastamızda da sitolojik inceleme için iğne aspirayonu yapılmış ve spesifik tanıya götüren özellikler saptanmıştır. Sellüler yaymada atipik görünümlü hücre saptanmamıştır. Bu görünüm ile metastatik ya da primer bir maligniteden uzaklaşılmıştır. Çok sayıda histiyositin bulunması ve bu histiyositlerin büyük büyütme ile incelenmesi sonucunda sitoplazmaları ndaki partiküllerin görülmesi spesifik bir etkeni akla getirmiştir. Daha önceki çalışmalar da göz önüne alınarak geniş bir literatür taraması yapılmış ve görülen bu intrasitoplamik partiküllerin T. gondii ile uyumlu olabileceği düşünülmüştür4,5,6,7. Ancak serolojik veriler bu yaklaşımı desteklememiştir. Bu durumda T. Gondii genomuna spesifik sekans PCR tekniği ile saptanarak tanı kesinleştirilmiştir. Hastalığın patogenezi incelendiğinde, erken dönemde seronegatifliğin bulunabileceği anlaşılmaktadır. Toksoplazmaya özgü IgM antikor düzeyi semptomların başlamasından 1 hafta sonra yükselmeye başlar8. Çünkü, mikroorganizma immün yanıtı uyarmadan önce makrofajlar içinde çoğalmaktadır. Bu erken aşamada makrofaj içerisinde bulunabilir, ancak seropozitiflik henüz gerçekleşmemiş olabilir.

    Viguer ve ark.'ları9 yaptıkları bir çalışmada, toksoplazma lenfadenitinin sitolojik tanısının sensitivitesi ve spesifitesinin oldukça yüksek olduğunu göstermiştir.

    Sonuç olarak, toksoplazma lenfadeniti sık rastlanan bir lenfadenopati nedenidir. Klinik olarak ortaya çıkış şekliyle, neoplastik ve nonneoplastik pek çok hastalığı akla getirebilir. Ayırıcı tanıda sitolojik inceleme önemli katkı sağlayabilir. Sitolojik bulgular toksoplazmozis ile uyumlu olmasına karşın, spesifik seropozitifliğin olmadığı durumlarda PCR ile spesifik DNA sekansının gösterilmesi ile tanı konulabilir.

  • Top
  • Abstract
  • Introduction
  • Case Presentation
  • Discussion
  • References
  • References

    1) Ioachim HL, Ratech H. Iochim's Lymph Node Pathology. 3rd ed., Philadelphia, Lippincott Williams&Wilkins; 2002. p. 173-174.

    2) Frosch MP, Anthony DC, Girolami UD. The Central Nervous System. In: Kumar V, Abbas A, Fausto N, editors. Robbins and Cotran Pathologic Basis of Disease 7th ed, Philadelphia, Elsevier Saunders; 2005. p.1379.

    3) Shimizu K, Ito I, Sasaki H, Takada E, Sunagawa M, Masawa N. Fine needle aspiration of toxoplasmic lymphadenitis in an intramammary lymph node. A case report. Acta Cytol 2001;45:259-262.

    4) Caraway NP, Katz RL. Lymph Nodes. In LG Koss ed. Koss's Diagnostic Cytology and Its Histopathologic Basis. 5th ed., Philadelphia, Lippincott Williams&Wilkins; 2006. p: 1195-1196.

    5) Pathan SK, Francis IM, Das DK, Mallik MK, Sheikh ZA, Hira PR. Fine needle aspiration cytologic diagnosis of toxoplasma lymphadenitis. A case report with detection of a Toxoplasma bradycyst in a Papanicolaou- stained smear. Acta Cytol 2003;47:299-303.

    6) Gupta RK. Fine needle aspiration cytodiagnosis of toxoplasmic lymphadenitis. Acta Cytol 1997;41:1031- 1034.

    7) Argyle JC, Schumann GB, Kjeldsberg CR, Athens JW. Identification of a toxoplasma cyst by fine-needle aspiration . Am J Clin Pathol 1983;80:256-258.

    8) Wilson M, McAuley JB. Toxoplazma. In M.A Pfaller, LS Garcia (eds.). Manual of Clinical Microbiology Parasitology Section, 7th ed., Washington D.C., ASM Press; 1999. p. 1376-1377.

    9) Viguer JM, Jimenez-Heffernan JA, Lopez-Ferrer P, Gonzalez-Peramato P, Vicandi B, Fine needle aspiration of toxoplasmic (Piringer-Kuchinka) lymphadenitis: a cytohistologic correlation study. Acta Cytol 2005;49:139-43.

  • Top
  • Abstract
  • Introduction
  • Case Presentation
  • Discussion
  • References
  • [ Top ] [ Abstract ] [ PDF ] [ Similar Articles ] [ E-Mail to Editor ]